|
Danaher Inc
alt rtm crispr guide rnas Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/bio_rxiv__2020__10__05__317925-593-11-16?v=Danaher+Inc Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc05797955-433-8-19?v=Addgene+inc Average 92 stars, based on 1 article reviews
guide rna - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
GenScript corporation
single-guide rnas targeting sting1 (sg sting1 -1: gtacccaatgtagtatgacc) Single Guide Rnas Targeting Sting1 (Sg Sting1 1: Gtacccaatgtagtatgacc), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc12046326-225-0-11?v=GenScript+corporation Average 90 stars, based on 1 article reviews
single-guide rnas targeting sting1 (sg sting1 -1: gtacccaatgtagtatgacc) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
BestGene Inc
guide rna plasmids Guide Rna Plasmids, supplied by BestGene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc10411561-87-1-21?v=BestGene+Inc Average 90 stars, based on 1 article reviews
guide rna plasmids - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Spectron Corporation
single-guide rnas (sgrnas) Single Guide Rnas (Sgrnas), supplied by Spectron Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc11912690-57-1-33?v=Spectron+Corporation Average 90 stars, based on 1 article reviews
single-guide rnas (sgrnas) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
zeb1 3′utrs with either mir-200c or mir-141 sites mutated Zeb1 3′Utrs With Either Mir 200c Or Mir 141 Sites Mutated, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc06220299-250-4-13?v=GenScript+corporation Average 90 stars, based on 1 article reviews
zeb1 3′utrs with either mir-200c or mir-141 sites mutated - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Biospring
amino guide rnas Amino Guide Rnas, supplied by Biospring, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pm40076283-179-1-7?v=Biospring Average 90 stars, based on 1 article reviews
amino guide rnas - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Genentech inc
epz-6438 (ezh2 inhibitor Epz 6438 (Ezh2 Inhibitor, supplied by Genentech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pm28781121-231-34-40?v=Genentech+inc Average 90 stars, based on 1 article reviews
epz-6438 (ezh2 inhibitor - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
hrh1-targeting single guide rna (sghrh1; 5’-cgatcaagtccgccaccgag-3) Hrh1 Targeting Single Guide Rna (Sghrh1; 5’ Cgatcaagtccgccaccgag 3), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc09895059-208-13-26?v=GenScript+corporation Average 90 stars, based on 1 article reviews
hrh1-targeting single guide rna (sghrh1; 5’-cgatcaagtccgccaccgag-3) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
human ikkβ guide rnas (grnas) ![]() Human Ikkβ Guide Rnas (Grnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc07898947-223-2-21?v=GenScript+corporation Average 90 stars, based on 1 article reviews
human ikkβ guide rnas (grnas) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
ndst1 guide rnas ![]() Ndst1 Guide Rnas, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc06737225-143-16-22?v=Broad+Institute+Inc Average 90 stars, based on 1 article reviews
ndst1 guide rnas - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
human ndufv1 guide rnas (grnas) ![]() Human Ndufv1 Guide Rnas (Grnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rnas/pmc06196495-266-1-10?v=GenScript+corporation Average 90 stars, based on 1 article reviews
human ndufv1 guide rnas (grnas) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cardiovascular Research
Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis
doi: 10.1093/cvr/cvaa118
Figure Lengend Snippet: Advanced glycolytic end (AGE) products activates IKKβ signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Article Snippet: Six different
Techniques: Western Blot, Activation Assay, Control, MANN-WHITNEY
Journal: Cardiovascular Research
Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis
doi: 10.1093/cvr/cvaa118
Figure Lengend Snippet: Constitutively activated forms of inflammation-activated protein kinases and increased pro-inflammatory cytokine secretion in atherosclerosis+T2DM MSCs. Augmented active T-loop phosphorylated forms of (A) IRAK 4 (*P = 0.05, atherosclerosis MSCs n = 5, atherosclerosis+T2DM MSCs n = 6), (B) TAK1 (*P = 0.02, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 12) and (C) IKKβ (****P < 0.000, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 11); (D) Increased phosphorylation of p65 NF-κB transcription factor on Ser536 located in its transactivation domain (*P = 0.05, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 12) and (E–G) Increased production of IKKβ–NF-κB-dependent pro-inflammatory cytokine IL-6 (***P = 0.0002, atherosclerosis MSCs n = 12, atherosclerosis+T2DM MSCs n = 11), and chemokines IL-8/CXCL8 (***P = 0.0006, atherosclerosis MSCs n = 11, atherosclerosis+T2DM MSCs n = 10), MCP-1/CCL2 (***P = 0.0002, atherosclerosis MSCs n = 11, atherosclerosis+T2DM MSCs n = 11). Each dot represents different biological samples (i.e. MSC from different donors). Mann–Whitney U test was used to compare two independent groups. Abbreviations: T2DM, type 2 diabetes mellitus; MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1.
Article Snippet: Six different
Techniques: Phospho-proteomics, MANN-WHITNEY
Journal: Cardiovascular Research
Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis
doi: 10.1093/cvr/cvaa118
Figure Lengend Snippet: Pharmacological inhibition of IKKβ reduces pro-inflammatory cytokine and chemokine secretion and rescues in vitro immunopotency of atherosclerosis+T2DM MSCs. (A–C) MLN120B treatment reduces the secretion of IL-6 (***P = 0.001, n = 11), IL-8/CXCL8 (**P = 0.003, n = 9), and MCP-1/CCL2(**P = 0.005, n = 10) in atherosclerosis+T2DM MSCs. (D) Representative example of flow cytometry proliferation. Histograms show CFSE dilution following in vitro proliferation of monocyte-depleted peripheral blood mononuclear cells (PBMCs) in co-culture with atherosclerosis+T2DM MSCs with or without the use of the IKKβ inhibitor MLN120B. (E) MLN120B improved the ability of atherosclerosis+T2DM MSCs to suppress the proliferation of activated T‐cells (***P = 0.0005, n = 12) while not affecting (F) CD4+ T cell viability (n = 12). (G and H) Similar immunopotency and CD4+ T cell viability in both cell–cell contact (n = 4) and trans-well conditions (n = 4) in MLN120B-treated atherosclerosis+T2DM MSCs. Each dot represents different biological samples (i.e. MSC from different donors). Mann–Whitney U test was used to compare two independent groups and Wilcoxon test was used for paired comparisons. Abbreviations: T2DM, type 2 diabetes mellitus; MSCs, mesenchymal stromal cells; IL 6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; FSC‐A, forward scatter area; SSC‐A, side scatter area; SSC‐H, side scatter height; SSC‐W, side scatter width; 7-AAD, 7-aminoactinomycin D; EI, expansion index; CFSE, carboxyfluorescein succinimidyl ester.
Article Snippet: Six different
Techniques: Inhibition, In Vitro, Flow Cytometry, Co-Culture Assay, MANN-WHITNEY
Journal: Cardiovascular Research
Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis
doi: 10.1093/cvr/cvaa118
Figure Lengend Snippet: IKKβ knockdown in atherosclerosis+T2DM-MSCs enhances their immunoprotective effects in the permanent LAD ligation model. (A) Representative western blots showing the efficacy of two different gRNA molecules targeting the IKBKB locus in one control MSCs left either untreated or exposed to 10 ng/mL TNF-α for 10 min. Note that the KD efficiency was evaluated in all the MSCs samples used in vivo (see Supplementary material online, Figure S11). The effect of reducing the expression level of IKKβ in atherosclerosis+T2DM MSCs was evaluated on their (B) immunopotency in vitro (***P = 0.001, n = 11) and (C) ability to attract PBMCs (*P = 0.02, n = 4). (D) Haematoxylin and Eosin (H&E) staining of the injured (i.e. purple: infiltration of leucocytes) and viable myocardium (i.e. pink) (**P = 0.007, n = 8), (E) CD4+ (*P = 0.01, n = 7), (F) Monocyte/macrophage (MOMA-2 staining) (*P = 0.01, n = 7), and (G) FOXP3 (**P = 0.007, n = 8) content in heart sections and (H) IL-6 plasma levels (*P = 0.01, n = 7) were assessed. Each dot represents different animals injected with six different biological samples (i.e. MSC from different donors). Wilcoxon test used for paired groups Abbreviations: T2DM, type 2 diabetes mellitus; PBMCs, peripheric blood mononuclear cells; MOMA, monoclonal anti-macrophage antibody; IL 6, interleukin-6.
Article Snippet: Six different
Techniques: Knockdown, Ligation, Western Blot, Control, In Vivo, Expressing, In Vitro, Staining, Clinical Proteomics, Injection
Journal: The Journal of Biological Chemistry
Article Title: Hepatic heparan sulfate is a master regulator of hepcidin expression and iron homeostasis in human hepatocytes and mice
doi: 10.1074/jbc.RA118.007213
Figure Lengend Snippet: Inactivation of NDST1 in Hep3B cells exhibits reduced hepcidin expression. A , sequence analysis of a region within exon-1 of NDST1 in WT Hep3B cells and in a cloned cell line obtained by targeting NDST1 by CRISPR/Cas9 ( NDST1 −/− ). The arrows indicate the start site of the altered DNA sequence in the mutant and the predicted amino acid sequence. Each allele results in a downstream frameshift mutation. B , FGF2 binding to WT and NDST1 −/− Hep3B cells. Loss of NDST1 results in diminished binding of FGF2 to HS. A set of WT cells were treated with heparin lyases I, II, and III (5 milliunits/ml) prior to flow cytometry ( n = 3 biological replicates, each performed in duplicate). The data were analyzed using one-way ANOVA with Tukey's multiple comparison test. C , HS from WT ( white bars ) and NDST1 −/− ( black bars ) cells were digested with heparin lyases I, II, and III and the liberated disaccharides were analyzed by LC-MS: D0H6, ΔUA-GlcNH 2 6S; D2H0, ΔUA2S-GlcNH 2 ; D0A0, ΔUA-GlcNAc; D0S0, ΔUA-GlcNS; D2H6, ΔUA2S-GlcNH 2 6S; D0A6, ΔUA-GlcNAc6S; D0S6, ΔUA-GlcNS6S; D2A0, ΔUA2S-GlcNAc; D2S0, ΔUA2S-GlcNS; D2A6, ΔUA2S-GlcNAc6S; D2S6, ΔUA2S-GlcNS6S; ΔUA, 4,5-unsaturated uronic acid . Disaccharide analysis was performed on a pool of three sets of cells ( n = 3 biological replicates that were pooled and analyzed). D , WT and NDST1 −/− cells were incubated with and without BMP6 (50 ng/ml) for 6 h and expression of HAMP mRNA was measured and normalized to GAPDH ( n = 2 wells). The data were analyzed using two-way ANOVA with uncorrected Fisher's least significant difference post hoc test.
Article Snippet: Mutant cell lines lacking GlcNAc N -deacetylase N -sulfotransferase-1 ( NDST1 −/− ) were generated using
Techniques: Expressing, Sequencing, Clone Assay, CRISPR, Mutagenesis, Binding Assay, Flow Cytometry, Comparison, Liquid Chromatography with Mass Spectroscopy, Incubation
Journal: The Journal of Biological Chemistry
Article Title: Hepatic heparan sulfate is a master regulator of hepcidin expression and iron homeostasis in human hepatocytes and mice
doi: 10.1074/jbc.RA118.007213
Figure Lengend Snippet: Reduction of HAMP expression and pSMAD5 in primary hepatocytes derived from Ndst1 f/f AlbCre + mice. A , level of Ndst1 mRNA in hepatocytes derived from Ndst1 f/f AlbCre − (control) and Ndst1 f/f AlbCre + (mutant) mice. B , level of NDST1 protein. C , level of Hamp mRNA. D , SMAD5 phosphorylation in primary hepatocytes derived from Ndst1 f/f AlbCre − and Ndst1 f/f AlbCre + mice treated with different concentrations of BMP6 for 6 h. Densitometry was performed using ImageJ and the values were normalized to SMAD5 as indicated ( n = 2).
Article Snippet: Mutant cell lines lacking GlcNAc N -deacetylase N -sulfotransferase-1 ( NDST1 −/− ) were generated using
Techniques: Expressing, Derivative Assay, Control, Mutagenesis, Phospho-proteomics
Journal: The Journal of Biological Chemistry
Article Title: Hepatic heparan sulfate is a master regulator of hepcidin expression and iron homeostasis in human hepatocytes and mice
doi: 10.1074/jbc.RA118.007213
Figure Lengend Snippet: Iron metabolism in Ndst1 f/f AlbCre + mice is altered. A , control Ndst1 f/f AlbCre − mice and mutant Ndst1 f/f AlbCre + mice were fed an iron-balanced diet ( IBD ) for 1 week (0 time point) and then switched to a iron-rich diet ( IRD ) for 1 or 3 weeks. B and C , Hamp mRNA ( B ) and serum hepcidin ( C ) were analyzed at the indicated time points. RNA expression was normalized to Tbp mRNA expression and the values were scaled to the values for the Ndst1 f/f AlbCre − control at the 0 time point. D , serum iron was measured at 0, 1, and 3 weeks. E and G , nonheme iron was measured by spectrophotometric assay in ( E ) liver and ( G ) spleen. F , representative image of Prussian blue stain and DAB enhancement of ferritin-iron in the liver of Ndst1 f/f AlbCre − and Ndst1 f/f AlbCre + mice at 0, 1, and 3 weeks of IRD. H , Western blot analysis of FPN, TfR1, FtL, pSMAD5, and SMAD5. The bands were quantitated with ImageJ and the values of pSMAD5 were normalized to SMAD5. All other band values were normalized to GAPDH ( n = 3 mice per group). Each point in B–F represents individual Ndst1 f/f AlbCre − ( open circles ) and Ndst1 f/f AlbCre + ( filled circles ) mice. Statistical analysis was performed by two-way ANOVA, t test and yielded the indicated p values.
Article Snippet: Mutant cell lines lacking GlcNAc N -deacetylase N -sulfotransferase-1 ( NDST1 −/− ) were generated using
Techniques: Control, Mutagenesis, RNA Expression, Expressing, Spectrophotometric Assay, Staining, Western Blot
Journal: The Journal of Biological Chemistry
Article Title: Hepatic heparan sulfate is a master regulator of hepcidin expression and iron homeostasis in human hepatocytes and mice
doi: 10.1074/jbc.RA118.007213
Figure Lengend Snippet: HS modulates IL6-induced HAMP mRNA expression in human hepatocytes. A , hepatocytes derived from Ndst1 f/f AlbCre + and Ndst1 f/f AlbCre − mice were treated with IL6 (50 ng/ml, 6 h), and Hamp mRNA was quantitated by qPCR ( n = 2). B , HepG2 cells were treated with 20 μ m surfen, and IL6 (50 ng/ml) was added for 6 h. The cells were collected for HAMP mRNA quantification by qPCR ( n = 4–7). C , HepG2 cells were treated with siRNAs to EXT1 and EXT2 or to GFP and after 48 h HAMP mRNA expression was measured. IL6 (50 ng/ml) was added during the last 6 h as indicated. D , Western blot analysis of pSTAT3. The bands were quantitated with ImageJ and expressed relative to STAT3 and then normalized to the values obtained from the untreated control ( n = 2–4). E , SOCS3 mRNA expression was measured in HepG2 cells treated with 20 μ m surfen with and without IL6 (50 ng/ml, 6 h). The values were normalized to HPRT1 expression and scaled to the value obtained in the absence of surfen and IL6 ( n = 3). F , HepG2 cells were treated with siRNAs to EXT1 and EXT2 or to GFP and after 48 h SOCS3 mRNA expression was measured. IL6 (50 ng/ml) was added during the last 6 h in some of the cultures. Values for mRNA expression were normalized to HPRT1 in the samples and expressed as the -fold change over the untreated cells ( n = 3).
Article Snippet: Mutant cell lines lacking GlcNAc N -deacetylase N -sulfotransferase-1 ( NDST1 −/− ) were generated using
Techniques: Expressing, Derivative Assay, Western Blot, Control
Journal: The Journal of Biological Chemistry
Article Title: Hepatic heparan sulfate is a master regulator of hepcidin expression and iron homeostasis in human hepatocytes and mice
doi: 10.1074/jbc.RA118.007213
Figure Lengend Snippet: Reduced sulfation of HS in Ndst1 f/f AlbCre + decreases Hamp mRNA and plasma hepcidin after LPS injection. Ndst1 f/f AlbCre + and Ndst1 f/f AlbCre − mice were fed an iron-balanced diet for 1 week and then treated with a single intraperitoneal dose of LPS (1 mg/kg). After 6 h, mice were sacrificed. A , liver Socs3 mRNA level was measured and normalized to Tbp mRNA. B , Hamp mRNA was measured in the liver and normalized to Tbp mRNA. C , serum hepcidin was measured before and after LPS treatment. D–F , serum iron ( D ), nonheme liver iron ( E ), and nonheme spleen iron ( F ) were measured by a spectrophotometric assay after PBS or LPS injection. G , hepatic pSTAT3 and pSMAD5 were measured by Western blotting. After quantitation of the bands by Image J, the values were normalized to STAT3 and SMAD5, respectively. H , Hep3B WT and NDST1 −/− cells were transfected with pGL2Hamp-luciferase and pGL2TK-Renilla plasmid along with scrambled siRNA and STAT3 siRNA and stimulated with 50 ng/ml of IL6 for 6 h. Luciferase and Renilla activity were measured. I , Hep3B WT and NDST1 −/− cells were transfected with pGL2Hamp-luciferase and pGL2TK-Renilla plasmid along with scrambled siRNA and SMAD5 siRNA and stimulated with 50 ng/ml of BMP6 for 6 h. Luciferase and Renilla activity were measured. n = 2 biological experiment done in triplicate. The data in each of the panels were analyzed by two-way ANOVA with post hoc Bonferroni multiple comparison test.
Article Snippet: Mutant cell lines lacking GlcNAc N -deacetylase N -sulfotransferase-1 ( NDST1 −/− ) were generated using
Techniques: Clinical Proteomics, Injection, Spectrophotometric Assay, Western Blot, Quantitation Assay, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Comparison
Journal: Proceedings of the National Academy of Sciences of the United States of America
Article Title: Papaverine and its derivatives radiosensitize solid tumors by inhibiting mitochondrial metabolism
doi: 10.1073/pnas.1808945115
Figure Lengend Snippet: Papaverine radiosensitizes through complex I inhibition. (A) Western blot of NDI1 expression in mitochondrial fractions of parent A549 and NDUFV1 KO cells. (B) Representative trypan blue viability (n = 3) of cells grown in galactose-only media (T = 96 h). Values represent mean viable cells ± SD. (C) Seahorse analysis of the response of parent A549 and NDUFV1 KO ± NDI1 cells to 10 μM papaverine or 1 μM rotenone. Values are mean ± SD. (D) Quantification of pimonidazole staining in NDUFV1 KO NDI1 flank tumors treated with 2 mg/kg PPV or vehicle (n = 3). Value is mean pimonidazole-positive cells from 20 images per tumor ± SEM. P value was calculated with t test. (E) Quantification of tumor growth delay of heterotopic NDUFV1 KO NDI1 flank xenografts receiving either 8 Gy XRT (magenta) or 2 mg/kg PPV 35 min before 8 Gy XRT (blue) (n = 4). Curves represent mean tumor volumes ± SEM. P values were calculated against XRT with t test. n.s., not significant.
Article Snippet: Three
Techniques: Inhibition, Western Blot, Expressing, Staining